OpenNeoantigens Protocol

A Public Commons for Shared Cancer Vaccine Targets with Blockchain-Verified Attribution

Daniel Uribe, CEO GenoBank.io

GenoBank Research Team

January 2026

Version 1.0 | Technical Specification

Executive Summary

OpenNeoantigens is a proposed public database and protocol for shared cancer neoantigen sequences derived from common driver mutations. Unlike private/patient-specific neoantigens that require individual tumor sequencing, shared neoantigens from hotspot mutations (KRAS G12D, TP53 R175H, BRAF V600E, etc.) are identical across all patients harboring those mutations and can be pre-computed, validated, and made freely available.

This specification defines the data architecture, HLA-peptide binding matrices, mRNA sequence designs, and blockchain attribution layer that together enable a public commons for cancer vaccine development. By open-sourcing the ~30% of targetable neoantigens that derive from shared mutations, we can dramatically accelerate access to personalized cancer immunotherapy while preserving attribution for contributors through Story Protocol IP registration.

OpenNeoantigens is not a replacement for fully personalized vaccines—it is a complementary public good that provides immediate, validated targets for patients with common driver mutations, while preserving the economic framework for patient-owned private neoantigens through the BioNFT system.

Table of Contents

1. Rationale: Why Open Source Neoantigens?

1.1 The Bottleneck Problem

Personalized neoantigen vaccines face a fundamental bottleneck: each patient requires individual tumor sequencing, neoantigen prediction, and custom mRNA synthesis. This process takes 6-8 weeks and costs $50,000-100,000+ per patient. For rapidly progressing cancers, this timeline can be fatal.

However, approximately 30% of actionable neoantigens derive from shared "hotspot" driver mutations that are identical across thousands or millions of patients:

93%
PDAC with KRAS mutations
50%
Melanoma with BRAF V600E
70%
Cancers with TP53 mutations
~200
Common hotspot mutations

These shared neoantigens can be pre-computed, pre-validated, and stockpiled—eliminating the 6-8 week delay for a significant fraction of targetable epitopes.

1.2 The Open Source Advantage

What Open Sourcing Enables

1.3 What Remains Proprietary

OpenNeoantigens does NOT open-source:

"OpenNeoantigens provides the blueprint. Manufacturing, delivery, and clinical implementation remain value-added services requiring specialized expertise."

2. Neoantigen Taxonomy: Shared vs. Private

2.1 Classification Framework

flowchart TB subgraph NEOANTIGENS["ALL NEOANTIGENS"] direction TB subgraph SHARED["SHARED (OpenNeoantigens)"] A["Driver Hotspots
KRAS G12D, BRAF V600E"] B["Recurrent Fusions
BCR-ABL, EML4-ALK"] C["Viral Oncoproteins
HPV E6/E7, EBV LMP"] end subgraph PRIVATE["PRIVATE (BioNFT-Protected)"] D["Passenger Mutations
Unique to each tumor"] E["Rare Variants
<1% population frequency"] F["Patient-Specific Fusions
Novel breakpoints"] end end SHARED --> G["OpenNeoantigens
Public Database"] PRIVATE --> H["Patient BioNFT
Sovereign Ownership"] G --> I["Free Access
Attribution Required"] H --> J["Consent-Gated
Economic Rights"]

Figure 1: Neoantigen classification determining open vs. proprietary status

2.2 Shared Neoantigen Criteria

A neoantigen qualifies for OpenNeoantigens inclusion if it meets ALL of the following criteria:

Criterion Requirement Rationale
Recurrence Present in ≥1% of a cancer type Sufficient patient population to benefit
Sequence Identity 100% amino acid identity across patients Same peptide = same vaccine target
Expression Consistently expressed when mutation present Driver mutations typically constitutively expressed
Actionability Predicted to bind ≥1 common HLA allele Must be presentable to T cells
No IP Encumbrance Sequence not covered by existing patents Must be freely usable

2.3 Initial Target Categories

Category A: Oncogenic Driver Mutations

Gene Hotspot Mutations Cancer Types Frequency
KRAS G12D, G12V, G12C, G12R, G13D, Q61H PDAC, CRC, NSCLC 25-95%
BRAF V600E, V600K Melanoma, CRC, Thyroid 40-60%
TP53 R175H, R248Q, R273H, R282W, G245S Pan-cancer 50-70%
PIK3CA E545K, H1047R, E542K Breast, Endometrial, CRC 20-40%
NRAS Q61R, Q61K, G12D Melanoma, AML 15-30%
IDH1 R132H, R132C Glioma, AML, Cholangiocarcinoma 70-90%
EGFR L858R, T790M, Exon 19 del NSCLC 10-50%

Category B: Oncogenic Fusion Proteins

Fusion Breakpoint Peptide Cancer Type Frequency
BCR-ABL Junction-spanning peptides CML, ALL 95%+ of CML
EML4-ALK Multiple variants (V1-V5) NSCLC 3-7% of NSCLC
TMPRSS2-ERG Junction peptides Prostate 40-50%
PML-RARA Junction peptides APL 95%+ of APL

Category C: Viral Oncoproteins

Virus Oncoproteins Cancer Type Association
HPV16/18 E6, E7 Cervical, Oropharyngeal, Anal 70%+ of cervical
EBV LMP1, LMP2, EBNA1 Nasopharyngeal, Hodgkin, Gastric Variable
HBV/HCV HBx, Core, NS proteins Hepatocellular carcinoma 70-80%
HTLV-1 Tax, HBZ Adult T-cell leukemia 100%

3. Database Architecture

3.1 Data Model

erDiagram MUTATION ||--o{ PEPTIDE : generates MUTATION { string mutation_id PK string gene string protein_change string dna_change string cosmic_id string dbsnp_id float population_frequency string[] cancer_types } PEPTIDE ||--o{ HLA_BINDING : has PEPTIDE { string peptide_id PK string mutation_id FK string sequence int length int start_position string flanking_sequence boolean is_mutant_residue_central } HLA_ALLELE ||--o{ HLA_BINDING : participates HLA_ALLELE { string hla_id PK string gene string allele_group string protein float population_frequency string[] population_distribution } HLA_BINDING { string binding_id PK string peptide_id FK string hla_id FK float ic50_nm float percentile_rank string prediction_tool string binding_category boolean validated_experimentally } PEPTIDE ||--o{ MRNA_DESIGN : encodes MRNA_DESIGN { string mrna_id PK string peptide_id FK string codon_optimized_sequence string five_prime_utr string three_prime_utr int poly_a_length string cap_structure float predicted_expression } PEPTIDE ||--o{ CLINICAL_EVIDENCE : has CLINICAL_EVIDENCE { string evidence_id PK string peptide_id FK string hla_id FK string trial_id int num_patients int num_responders string response_type string publication_doi string data_source }

Figure 2: OpenNeoantigens database entity-relationship diagram

3.2 Core Tables Schema

{ "mutations": { "mutation_id": "KRAS_G12D", "gene": "KRAS", "transcript": "ENST00000311936", "protein_change": "p.G12D", "dna_change": "c.35G>A", "chromosome": "12", "position": 25398284, "ref": "C", "alt": "T", "cosmic_id": "COSM521", "clinvar_id": "12582", "population_frequency": 0.0, "somatic_frequency": { "PDAC": 0.41, "CRC": 0.13, "NSCLC": 0.04 }, "functional_impact": "oncogenic_driver", "druggability": "emerging", "references": ["PMID:33106528", "PMID:34534430"] } }
{ "peptides": { "peptide_id": "KRAS_G12D_9mer_pos7", "mutation_id": "KRAS_G12D", "sequence": "VVVGADGVG", "length": 9, "mutant_position": 4, "wildtype_sequence": "VVVGAGGVG", "flanking_n": "MTEYKLVVV", "flanking_c": "GVGKSALTI", "physicochemical": { "molecular_weight": 771.87, "isoelectric_point": 5.52, "hydrophobicity": 0.73, "instability_index": 32.4 } } }
{ "hla_binding": { "binding_id": "KRAS_G12D_9mer_HLA-A0201", "peptide_id": "KRAS_G12D_9mer_pos7", "hla_allele": "HLA-A*02:01", "predictions": { "netmhcpan_4.1": { "ic50_nm": 45.2, "percentile_rank": 0.12, "binding_level": "strong" }, "mhcflurry_2.0": { "ic50_nm": 52.8, "percentile_rank": 0.15, "binding_level": "strong" }, "consensus": { "ic50_nm": 49.0, "confidence": "high" } }, "experimental_validation": { "validated": true, "method": "competitive_binding_assay", "measured_ic50_nm": 38.5, "source": "IEDB:1234567" } } }

3.3 Storage Architecture

Distributed Storage Model

4. HLA-Peptide Binding Matrix

4.1 HLA Coverage Strategy

The human population expresses thousands of HLA alleles, but coverage can be achieved efficiently by targeting the most common alleles:

HLA Class Priority Alleles Cumulative Coverage
Class I (CD8+ T cells) HLA-A*02:01 ~40% of Caucasians
HLA-A*01:01 +15% = 55%
HLA-A*03:01 +12% = 67%
HLA-A*11:01 +10% = 77%
HLA-A*24:02 +8% = 85%
+ Top 20 B alleles >95% global coverage
Class II (CD4+ T cells) HLA-DRB1*01:01 Common helper epitopes
HLA-DRB1*03:01 Enhanced CD4+ response
HLA-DRB1*04:01 Broader coverage

4.2 Binding Prediction Pipeline

flowchart LR A[Mutation] --> B[Generate All
8-11mer Peptides] B --> C{NetMHCpan 4.1} B --> D{MHCflurry 2.0} B --> E{NetMHCIIpan 4.0} C --> F[Class I
Predictions] D --> F E --> G[Class II
Predictions] F --> H{Consensus
Filter} G --> H H --> I["Strong Binders
(IC50 < 50nM)"] H --> J["Moderate Binders
(IC50 50-500nM)"] H --> K["Weak/Non-binders
(IC50 > 500nM)"] I --> L[Priority 1:
Validated Targets] J --> M[Priority 2:
Experimental Candidates]

Figure 3: Multi-tool consensus binding prediction pipeline

4.3 Example: KRAS G12D Binding Matrix

Peptide Length HLA-A*02:01 HLA-A*03:01 HLA-A*11:01 HLA-B*07:02
VVGADGVGK 9 2450 nM ❌ 45 nM ✅ 38 nM ✅ 8920 nM ❌
VVVGADGVG 9 52 nM ✅ 380 nM ⚠️ 245 nM ⚠️ 5670 nM ❌
KLVVVGADGV 10 28 nM ✅✅ 1890 nM ❌ 2340 nM ❌ 7800 nM ❌
LVVVGADGVG 10 67 nM ✅ 290 nM ⚠️ 89 nM ✅ 4500 nM ❌
VVVGADGVGK 10 3200 nM ❌ 62 nM ✅ 55 nM ✅ 6700 nM ❌

Legend: ✅✅ Strong binder (<50 nM) | ✅ Good binder (50-150 nM) | ⚠️ Moderate (150-500 nM) | ❌ Weak/Non-binder (>500 nM)

Key Insight: HLA-Matched Peptide Selection

A patient with HLA-A*02:01 and KRAS G12D should receive the KLVVVGADGV 10-mer (IC50 = 28 nM).

A patient with HLA-A*11:01 and KRAS G12D should receive the VVGADGVGK 9-mer (IC50 = 38 nM).

Same mutation. Different optimal peptides. This is why HLA matching is critical.

5. Pre-Designed mRNA Sequences

5.1 mRNA Architecture

┌─────────────────────────────────────────────────────────────────────────────────┐
│                        OpenNeoantigens mRNA Construct                           │
├─────────────────────────────────────────────────────────────────────────────────┤
│                                                                                  │
│  5' Cap ─── 5' UTR ─── Signal ─── [Neoantigen Cassette] ─── 3' UTR ─── PolyA   │
│    │          │          │                  │                   │         │     │
│   Cap1    Optimized   Secretion      Multiple epitopes      Stabilizing  120nt │
│  (m7G)    Kozak       peptide        with linkers           elements           │
│                                                                                  │
│  ┌──────────────────────────────────────────────────────────────────────────┐  │
│  │                     NEOANTIGEN CASSETTE DETAIL                            │  │
│  │                                                                           │  │
│  │  [Epitope1]──AAY──[Epitope2]──AAY──[Epitope3]──AAY──...──[Epitope20]    │  │
│  │      │                                                        │          │  │
│  │   25-mer                                                   25-mer        │  │
│  │  (8aa flank + 9mer + 8aa flank)                                          │  │
│  │                                                                           │  │
│  │  AAY = Alanine-Alanine-Tyrosine linker (proteasomal cleavage site)      │  │
│  └──────────────────────────────────────────────────────────────────────────┘  │
│                                                                                  │
└─────────────────────────────────────────────────────────────────────────────────┘

Figure 4: mRNA vaccine construct architecture for multi-epitope delivery

5.2 Codon Optimization

Each peptide sequence is reverse-translated using optimized codons for human expression:

# Example: KRAS G12D epitope KLVVVGADGV Wild-type AA: K L V V V G A D G V Optimized: AAG CTG GTG GTG GTG GGC GCC GAC GGC GTG Key optimizations: - GC content: 55-65% (optimal for stability) - Avoid rare codons (<10% usage) - Eliminate mRNA secondary structures - Remove cryptic splice sites - Eliminate poly-U stretches (immunogenic) - Substitute all U → N1-methylpseudouridine (Ψ)

5.3 mRNA Sequence Repository

{ "mrna_design": { "design_id": "OPEN-NEO-KRAS-G12D-A0201-v1", "target_mutation": "KRAS_G12D", "target_hla": "HLA-A*02:01", "peptide_sequence": "KLVVVGADGV", "construct": { "five_prime_cap": "CleanCap_AG", "five_prime_utr": "GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC", "signal_peptide": "MFVFLVLLPLVSSQCVNLT", "epitope_with_flanks": "MTEYKLVVVKLVVVGADGVGKSALTI", "linker": "AAY", "three_prime_utr": "GCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCC...", "poly_a_length": 120 }, "full_sequence_length": 847, "gc_content": 0.58, "predicted_half_life_hours": 18.5, "modifications": { "uridine": "N1-methylpseudouridine", "cap": "Cap1" }, "version": "1.0", "validation_status": "computationally_validated", "license": "CC-BY-SA-4.0", "attribution_ip_id": "0x1234...Story_Protocol_IP_ID" } }

5.4 Multi-Epitope Constructs

For patients with multiple targetable shared mutations, multi-epitope mRNA constructs can be pre-designed:

Example: PDAC Multi-Target Vaccine

Patient profile: KRAS G12D + TP53 R175H + CDKN2A loss + SMAD4 R361H

HLA type: A*02:01, A*03:01, B*07:02

OpenNeoantigens construct:

Construct ID: OPEN-NEO-PDAC-MULTI-A0201-A0301-v1

6. Clinical Validation Framework

6.1 Evidence Hierarchy

Level Evidence Type Requirements Database Status
1 Clinical response Documented T-cell response + clinical benefit in trial VALIDATED
2 Immunogenic (human) T-cell response in human study, no clinical data yet VALIDATED
3 Immunogenic (preclinical) T-cell response in mouse model with human HLA transgene EXPERIMENTAL
4 Binding validated Experimental peptide-MHC binding assay EXPERIMENTAL
5 Predicted only Computational prediction, no experimental validation COMPUTATIONAL

6.2 Response Tracking Schema

{ "clinical_evidence": { "evidence_id": "CE-2024-00142", "peptide_id": "KRAS_G12D_10mer_pos5", "hla_allele": "HLA-A*02:01", "trial": { "trial_id": "NCT04117087", "phase": "1/2", "sponsor": "Elicio Therapeutics", "vaccine": "ELI-002" }, "cohort": { "n_patients": 25, "cancer_types": ["PDAC", "CRC"], "hla_matched": true }, "outcomes": { "t_cell_responders": 20, "response_rate": 0.80, "median_magnitude": "2.3-fold increase", "duration_months": 12, "clinical_benefit": { "ctdna_clearance": 0.45, "ca19_9_reduction": 0.84 } }, "publication": { "doi": "10.1038/s41591-024-XXXXX", "pubmed_id": "38XXXXXX" }, "data_contributed_by": "0xABC...contributor_wallet", "contribution_timestamp": "2024-06-15T14:30:00Z" } }

6.3 Community Validation Process

flowchart TD A[New Clinical Data
Submitted] --> B{Data Quality
Review} B -->|Pass| C[Curator Review] B -->|Fail| D[Request
Clarification] D --> A C --> E{Validation
Committee} E -->|Approved| F[Update Database] E -->|Questions| G[Request Additional
Documentation] G --> C F --> H[Attribution Recorded
on Story Protocol] H --> I[Contributor Receives
IP Credit] subgraph "Validation Committee" J[3+ Independent
Oncologists] K[Biostatistician] L[Immunologist] end

Figure 5: Clinical evidence validation and attribution workflow

7. Blockchain Attribution Layer

7.1 Story Protocol Integration

Every contribution to OpenNeoantigens is registered as an IP Asset on Story Protocol, ensuring permanent attribution:

What Gets Attributed

7.2 IP Asset Structure

{ "ip_asset": { "ip_id": "0x7890...OpenNeoantigens_KRAS_G12D", "ip_type": "OPEN_NEOANTIGEN", "metadata": { "name": "KRAS G12D Neoantigen Dataset", "description": "Complete HLA binding matrix and mRNA designs for KRAS G12D", "mutation": "KRAS_G12D", "content_hash": "QmXyz...IPFS_hash", "version": "2.3.0" }, "contributors": [ { "address": "0xAAA...", "role": "original_submitter", "contribution": "Initial peptide predictions", "share": 40 }, { "address": "0xBBB...", "role": "experimental_validator", "contribution": "Binding assay data", "share": 30 }, { "address": "0xCCC...", "role": "clinical_contributor", "contribution": "Phase 1 response data", "share": 30 } ], "license": { "type": "PIL_PUBLIC_GOOD", "terms": { "commercial_use": true, "attribution_required": true, "derivatives_allowed": true, "share_alike": true } } } }

7.3 License Framework

License Type Commercial Use Attribution Derivatives Use Case
PIL #4: Public Good ✅ Free ✅ Required ✅ Share-alike Core database entries
PIL #1: Non-Commercial ❌ No ✅ Required ✅ Allowed Research-only datasets
PIL #2: Commercial ✅ Royalty ✅ Required ✅ Negotiable Pharma-contributed data

7.4 Attribution NFT

Contributors receive a non-transferable Attribution NFT recording their contribution:

// OpenNeoantigens Attribution NFT (Soulbound) contract OpenNeoantigenAttribution is ERC721, Soulbound { struct Contribution { string mutationId; string contributionType; // "sequence", "binding_data", "clinical", "curation" uint256 timestamp; string ipfsMetadataHash; uint256 citationCount; } mapping(uint256 => Contribution) public contributions; mapping(address => uint256[]) public contributorTokens; function mint( address contributor, string memory mutationId, string memory contributionType, string memory metadataHash ) external onlyValidator returns (uint256) { // Mint soulbound attribution NFT // Cannot be transferred, but proves permanent credit } function incrementCitation(uint256 tokenId) external { // Called when someone uses/cites this contribution contributions[tokenId].citationCount++; } }

8. API Specification

8.1 REST API Endpoints

BASE URL: https://api.openneoantigens.org/v1 # Query neoantigens by mutation GET /mutations/{mutation_id} GET /mutations?gene=KRAS&change=G12D # Get HLA binding predictions GET /bindings?mutation=KRAS_G12D&hla=HLA-A*02:01 GET /bindings/matrix?mutation=KRAS_G12D # Get pre-designed mRNA sequences GET /mrna?mutation=KRAS_G12D&hla=HLA-A*02:01 GET /mrna/{design_id} # Query by patient HLA profile POST /match { "mutations": ["KRAS_G12D", "TP53_R175H"], "hla_class_i": ["HLA-A*02:01", "HLA-A*03:01", "HLA-B*07:02"], "hla_class_ii": ["HLA-DRB1*01:01"] } # Get clinical evidence GET /evidence?mutation=KRAS_G12D&hla=HLA-A*02:01 GET /evidence?trial_id=NCT04117087 # Submit new data (authenticated) POST /contributions/binding POST /contributions/clinical POST /contributions/mrna

8.2 GraphQL Schema

type Query { mutation(id: ID!): Mutation mutations(gene: String, cancerType: String): [Mutation!]! peptide(id: ID!): Peptide peptides(mutationId: ID!, minLength: Int, maxLength: Int): [Peptide!]! binding(peptideId: ID!, hlaAllele: String!): HLABinding bindingMatrix(mutationId: ID!): BindingMatrix! matchPatient(input: PatientMatchInput!): PatientMatchResult! mrnaDesign(id: ID!): MRNADesign mrnaDesigns(mutationId: ID!, hlaAllele: String): [MRNADesign!]! clinicalEvidence(mutationId: ID, trialId: String): [ClinicalEvidence!]! } type Mutation { id: ID! gene: String! proteinChange: String! dnaChange: String! cosmicId: String somaticFrequency: [CancerFrequency!]! peptides: [Peptide!]! clinicalEvidence: [ClinicalEvidence!]! } type Peptide { id: ID! sequence: String! length: Int! mutantPosition: Int! bindings: [HLABinding!]! mrnaDesigns: [MRNADesign!]! } type HLABinding { id: ID! hlaAllele: String! ic50Nm: Float! percentileRank: Float! bindingLevel: BindingLevel! predictionTools: [PredictionResult!]! experimentalValidation: ExperimentalValidation } type MRNADesign { id: ID! fullSequence: String! gcContent: Float! predictedHalfLife: Float! license: String! attributionIpId: String! } input PatientMatchInput { mutations: [String!]! hlaClassI: [String!]! hlaClassII: [String!] cancerType: String } type PatientMatchResult { recommendedPeptides: [PeptideRecommendation!]! mrnaConstructs: [MRNADesign!]! clinicalEvidence: [ClinicalEvidence!]! coverageScore: Float! }

8.3 SDK Examples

# Python SDK Example from openneoantigens import OpenNeoClient client = OpenNeoClient(api_key="your_api_key") # Find optimal epitopes for a patient result = client.match_patient( mutations=["KRAS_G12D", "TP53_R175H"], hla_class_i=["HLA-A*02:01", "HLA-A*11:01"], hla_class_ii=["HLA-DRB1*04:01"] ) for peptide in result.recommended_peptides: print(f"{peptide.sequence} | {peptide.hla} | IC50: {peptide.ic50_nm}nM | Evidence: {peptide.evidence_level}") # Output: # KLVVVGADGV | HLA-A*02:01 | IC50: 28nM | Evidence: CLINICAL_RESPONSE # VVGADGVGK | HLA-A*11:01 | IC50: 38nM | Evidence: IMMUNOGENIC_HUMAN # HMTEVVRHC | HLA-A*02:01 | IC50: 156nM | Evidence: BINDING_VALIDATED # Get ready-to-manufacture mRNA sequence mrna = client.get_mrna_design( mutation="KRAS_G12D", hla="HLA-A*02:01" ) print(f"mRNA construct: {mrna.design_id}") print(f"Sequence length: {mrna.sequence_length} nt") print(f"License: {mrna.license}") # CC-BY-SA-4.0

9. Governance Model

9.1 OpenNeoantigens DAO

flowchart TB subgraph DAO["OpenNeoantigens DAO"] A[Token Holders
Governance Votes] B[Scientific Advisory
Board] C[Validation
Committee] D[Technical
Committee] end subgraph DECISIONS["Governance Scope"] E[Inclusion Criteria
Updates] F[Evidence Standards
Changes] G[API Access
Policies] H[Attribution Rules
Modifications] I[Treasury
Allocation] end A --> E A --> G A --> I B --> E B --> F C --> F D --> G D --> H

Figure 6: OpenNeoantigens DAO governance structure

9.2 Governance Token

ONEO Token Distribution

Earning ONEO: 1 token per validated peptide-HLA submission, 10 tokens per clinical evidence contribution, 5 tokens per mRNA design, 0.5 tokens per curation review.

9.3 Scientific Advisory Board

The SAB provides scientific oversight and consists of:

SAB members serve 3-year terms, renewable once. They review evidence standards, resolve disputes, and guide research priorities.

10. Integration with BioNFT Ecosystem

10.1 Hybrid Vaccine Strategy

OpenNeoantigens complements—not replaces—the patient-owned BioNFT system:

flowchart LR subgraph PATIENT["Patient with PDAC"] A[Tumor Biopsy] B[HLA Typing] end subgraph ANALYSIS["Neoantigen Analysis"] C[Shared Mutations
KRAS G12D, TP53 R175H] D[Private Mutations
Unique passengers] end A --> C A --> D B --> C B --> D subgraph OPEN["OpenNeoantigens"] E[Pre-validated
Peptides] F[Ready mRNA
Designs] end subgraph BIONFT["Patient BioNFT"] G[Private Neoantigen
Sequences] H[Custom mRNA
Designs] end C --> E E --> F D --> G G --> H F --> I[Combined
Vaccine] H --> I I --> J["Multi-epitope mRNA Vaccine
Shared (free) + Private (patient-owned)"]

Figure 7: Integration of OpenNeoantigens with patient-owned BioNFT system

10.2 API Integration

# GenoBank BioNFT API integration with OpenNeoantigens # Patient's BioNFT contains their private neoantigens patient_bionft = genobank.get_bionft(biosample_id="99990000000001") # Query OpenNeoantigens for their shared mutations shared_targets = openneo.match_patient( mutations=patient_bionft.shared_mutations, # ["KRAS_G12D", "TP53_R175H"] hla=patient_bionft.hla_type ) # Combine with patient's private neoantigens private_targets = patient_bionft.private_neoantigens # Patient-owned, consent-gated # Generate combined vaccine design vaccine_design = genobank.design_vaccine( shared_epitopes=shared_targets.peptides, # From OpenNeoantigens (free) private_epitopes=private_targets.peptides, # From BioNFT (patient-owned) patient_hla=patient_bionft.hla_type ) # Attribution tracking vaccine_design.attribution = { "shared_components": shared_targets.attribution_ip_ids, # Story Protocol IPs "private_components": patient_bionft.ip_id, # Patient's BioNFT IP "design_contributor": "GenoBank.io" }

10.3 Economic Model

Component Source Cost to Patient Attribution
Shared neoantigen sequences OpenNeoantigens Free CC-BY-SA (cite database)
Pre-designed mRNA (shared) OpenNeoantigens Free Story Protocol IP credit
Private neoantigen sequences Patient BioNFT Patient-owned Patient retains 100% IP
Custom mRNA design GenoBank/CDMO Service fee Design IP to patient
GMP Manufacturing CDMO Partner Manufacturing cost Process IP to CDMO
Clinical administration Physician Medical fee N/A

11. Implementation Roadmap

Phase 1: Foundation (Q1-Q2 2026)

Phase 2: Expansion (Q3-Q4 2026)

Phase 3: Validation (2027)

Phase 4: Scale (2028+)

12. Appendix: Initial Mutation Set

12.1 Priority 1: High-Frequency Drivers (Launch Set)

# Gene Mutation Cancer Types Frequency Existing Vaccine Data
1 KRAS G12D PDAC, CRC, NSCLC 13-41% ELI-002, autogene cevumeran
2 KRAS G12V PDAC, CRC, NSCLC 8-30% ELI-002
3 KRAS G12C NSCLC, CRC 3-13% Multiple programs
4 KRAS G12R PDAC 16% ELI-002
5 KRAS G13D CRC 7% Limited
6 BRAF V600E Melanoma, CRC, Thyroid 40-60% Multiple trials
7 TP53 R175H Pan-cancer 6% Limited
8 TP53 R248Q Pan-cancer 4% Limited
9 TP53 R273H Pan-cancer 4% Limited
10 PIK3CA H1047R Breast, Endometrial 15-30% Limited
11 PIK3CA E545K Breast, Endometrial 10-15% Limited
12 IDH1 R132H Glioma, AML 70-90% Peptide vaccine trials
13 NRAS Q61R Melanoma 15% Limited
14 NRAS Q61K Melanoma, AML 10% Limited
15 EGFR L858R NSCLC 10-15% Limited

12.2 Priority 2: Fusion Proteins

Fusion Cancer Type Frequency Junction Peptides
BCR-ABL (p210) CML 95% ATGFKQSSKALQRPVAS
BCR-ABL (p190) ALL 25% HSATGFKQSSKALQRPVAS
EML4-ALK V1 NSCLC 2% To be characterized
EML4-ALK V3 NSCLC 2% To be characterized
TMPRSS2-ERG Prostate 50% To be characterized

12.3 Priority 3: Viral Oncoproteins

Virus Protein Cancer Type Known Epitopes
HPV16 E6 Cervical, Oropharyngeal Multiple HLA-restricted epitopes characterized
HPV16 E7 Cervical, Oropharyngeal YMLDLQPETT (HLA-A*02:01)
HPV18 E6, E7 Cervical Multiple characterized
EBV LMP1, LMP2 Nasopharyngeal, Hodgkin Extensive database available

Summary

OpenNeoantigens represents a new paradigm in cancer vaccine development: a public commons for shared cancer targets that accelerates access while preserving attribution through blockchain technology. By open-sourcing the ~30% of neoantigens derived from common driver mutations, we can:

The protocol launches with 15 high-priority mutations covering the most common oncogenic drivers, with plans to expand to 200+ mutations and comprehensive fusion/viral databases by 2027.

OpenNeoantigens + BioNFTs = Complete patient sovereignty over cancer immunotherapy.


OpenNeoantigens Protocol

A GenoBank.io Initiative

January 2026 | Version 1.0

Contact: [email protected]

genobank.io | GitHub | Discord