OpenNeoantigens Protocol
A Public Commons for Shared Cancer Vaccine Targets with Blockchain-Verified Attribution
Daniel Uribe, CEO GenoBank.io
GenoBank Research Team
January 2026
Version 1.0 | Technical Specification
Executive Summary
OpenNeoantigens is a proposed public database and protocol for shared cancer neoantigen sequences derived from common driver mutations. Unlike private/patient-specific neoantigens that require individual tumor sequencing, shared neoantigens from hotspot mutations (KRAS G12D, TP53 R175H, BRAF V600E, etc.) are identical across all patients harboring those mutations and can be pre-computed, validated, and made freely available.
This specification defines the data architecture, HLA-peptide binding matrices, mRNA sequence designs, and blockchain attribution layer that together enable a public commons for cancer vaccine development. By open-sourcing the ~30% of targetable neoantigens that derive from shared mutations, we can dramatically accelerate access to personalized cancer immunotherapy while preserving attribution for contributors through Story Protocol IP registration.
OpenNeoantigens is not a replacement for fully personalized vaccines—it is a complementary public good that provides immediate, validated targets for patients with common driver mutations, while preserving the economic framework for patient-owned private neoantigens through the BioNFT system.
1. Rationale: Why Open Source Neoantigens?
1.1 The Bottleneck Problem
Personalized neoantigen vaccines face a fundamental bottleneck: each patient requires individual tumor sequencing, neoantigen prediction, and custom mRNA synthesis. This process takes 6-8 weeks and costs $50,000-100,000+ per patient. For rapidly progressing cancers, this timeline can be fatal.
However, approximately 30% of actionable neoantigens derive from shared "hotspot" driver mutations that are identical across thousands or millions of patients:
93%
PDAC with KRAS mutations
50%
Melanoma with BRAF V600E
70%
Cancers with TP53 mutations
~200
Common hotspot mutations
These shared neoantigens can be pre-computed, pre-validated, and stockpiled—eliminating the 6-8 week delay for a significant fraction of targetable epitopes.
1.2 The Open Source Advantage
What Open Sourcing Enables
- Immediate availability: No waiting for individual tumor sequencing for shared targets
- Massive validation: Clinical response data pooled across thousands of patients
- Manufacturing efficiency: CDMOs can stockpile common mRNA sequences
- Global access: Low-resource settings can access validated vaccine designs
- Combination strategies: Shared neoantigens + private neoantigens in single vaccine
1.3 What Remains Proprietary
OpenNeoantigens does NOT open-source:
- Private/passenger neoantigens: Unique to each patient's tumor—these remain patient-owned via BioNFTs
- Manufacturing processes: GMP production methods remain CDMO intellectual property
- Delivery systems: LNP formulations, adjuvants, etc. remain proprietary
- Clinical protocols: Dosing, scheduling, combination therapies require regulatory expertise
"OpenNeoantigens provides the blueprint. Manufacturing, delivery, and clinical implementation remain value-added services requiring specialized expertise."
2. Neoantigen Taxonomy: Shared vs. Private
2.1 Classification Framework
2.2 Shared Neoantigen Criteria
A neoantigen qualifies for OpenNeoantigens inclusion if it meets ALL of the following criteria:
| Criterion |
Requirement |
Rationale |
| Recurrence |
Present in ≥1% of a cancer type |
Sufficient patient population to benefit |
| Sequence Identity |
100% amino acid identity across patients |
Same peptide = same vaccine target |
| Expression |
Consistently expressed when mutation present |
Driver mutations typically constitutively expressed |
| Actionability |
Predicted to bind ≥1 common HLA allele |
Must be presentable to T cells |
| No IP Encumbrance |
Sequence not covered by existing patents |
Must be freely usable |
2.3 Initial Target Categories
Category A: Oncogenic Driver Mutations
| Gene |
Hotspot Mutations |
Cancer Types |
Frequency |
| KRAS |
G12D, G12V, G12C, G12R, G13D, Q61H |
PDAC, CRC, NSCLC |
25-95% |
| BRAF |
V600E, V600K |
Melanoma, CRC, Thyroid |
40-60% |
| TP53 |
R175H, R248Q, R273H, R282W, G245S |
Pan-cancer |
50-70% |
| PIK3CA |
E545K, H1047R, E542K |
Breast, Endometrial, CRC |
20-40% |
| NRAS |
Q61R, Q61K, G12D |
Melanoma, AML |
15-30% |
| IDH1 |
R132H, R132C |
Glioma, AML, Cholangiocarcinoma |
70-90% |
| EGFR |
L858R, T790M, Exon 19 del |
NSCLC |
10-50% |
Category B: Oncogenic Fusion Proteins
| Fusion |
Breakpoint Peptide |
Cancer Type |
Frequency |
| BCR-ABL |
Junction-spanning peptides |
CML, ALL |
95%+ of CML |
| EML4-ALK |
Multiple variants (V1-V5) |
NSCLC |
3-7% of NSCLC |
| TMPRSS2-ERG |
Junction peptides |
Prostate |
40-50% |
| PML-RARA |
Junction peptides |
APL |
95%+ of APL |
Category C: Viral Oncoproteins
| Virus |
Oncoproteins |
Cancer Type |
Association |
| HPV16/18 |
E6, E7 |
Cervical, Oropharyngeal, Anal |
70%+ of cervical |
| EBV |
LMP1, LMP2, EBNA1 |
Nasopharyngeal, Hodgkin, Gastric |
Variable |
| HBV/HCV |
HBx, Core, NS proteins |
Hepatocellular carcinoma |
70-80% |
| HTLV-1 |
Tax, HBZ |
Adult T-cell leukemia |
100% |
3. Database Architecture
3.1 Data Model
3.2 Core Tables Schema
{
"mutations": {
"mutation_id": "KRAS_G12D",
"gene": "KRAS",
"transcript": "ENST00000311936",
"protein_change": "p.G12D",
"dna_change": "c.35G>A",
"chromosome": "12",
"position": 25398284,
"ref": "C",
"alt": "T",
"cosmic_id": "COSM521",
"clinvar_id": "12582",
"population_frequency": 0.0,
"somatic_frequency": {
"PDAC": 0.41,
"CRC": 0.13,
"NSCLC": 0.04
},
"functional_impact": "oncogenic_driver",
"druggability": "emerging",
"references": ["PMID:33106528", "PMID:34534430"]
}
}
{
"peptides": {
"peptide_id": "KRAS_G12D_9mer_pos7",
"mutation_id": "KRAS_G12D",
"sequence": "VVVGADGVG",
"length": 9,
"mutant_position": 4,
"wildtype_sequence": "VVVGAGGVG",
"flanking_n": "MTEYKLVVV",
"flanking_c": "GVGKSALTI",
"physicochemical": {
"molecular_weight": 771.87,
"isoelectric_point": 5.52,
"hydrophobicity": 0.73,
"instability_index": 32.4
}
}
}
{
"hla_binding": {
"binding_id": "KRAS_G12D_9mer_HLA-A0201",
"peptide_id": "KRAS_G12D_9mer_pos7",
"hla_allele": "HLA-A*02:01",
"predictions": {
"netmhcpan_4.1": {
"ic50_nm": 45.2,
"percentile_rank": 0.12,
"binding_level": "strong"
},
"mhcflurry_2.0": {
"ic50_nm": 52.8,
"percentile_rank": 0.15,
"binding_level": "strong"
},
"consensus": {
"ic50_nm": 49.0,
"confidence": "high"
}
},
"experimental_validation": {
"validated": true,
"method": "competitive_binding_assay",
"measured_ic50_nm": 38.5,
"source": "IEDB:1234567"
}
}
}
3.3 Storage Architecture
Distributed Storage Model
- Primary Database: PostgreSQL with TimescaleDB for clinical time-series data
- Search Index: Elasticsearch for peptide sequence similarity search
- Blob Storage: IPFS for mRNA sequence files (pinned, with deletion capability via gateway)
- Cache Layer: Redis for frequently accessed HLA-binding lookups
- Blockchain Index: Story Protocol for attribution records (on-chain)
4. HLA-Peptide Binding Matrix
4.1 HLA Coverage Strategy
The human population expresses thousands of HLA alleles, but coverage can be achieved efficiently by targeting the most common alleles:
| HLA Class |
Priority Alleles |
Cumulative Coverage |
| Class I (CD8+ T cells) |
HLA-A*02:01 |
~40% of Caucasians |
| HLA-A*01:01 |
+15% = 55% |
| HLA-A*03:01 |
+12% = 67% |
| HLA-A*11:01 |
+10% = 77% |
| HLA-A*24:02 |
+8% = 85% |
| + Top 20 B alleles |
>95% global coverage |
| Class II (CD4+ T cells) |
HLA-DRB1*01:01 |
Common helper epitopes |
| HLA-DRB1*03:01 |
Enhanced CD4+ response |
| HLA-DRB1*04:01 |
Broader coverage |
4.2 Binding Prediction Pipeline
4.3 Example: KRAS G12D Binding Matrix
| Peptide |
Length |
HLA-A*02:01 |
HLA-A*03:01 |
HLA-A*11:01 |
HLA-B*07:02 |
| VVGADGVGK |
9 |
2450 nM ❌ |
45 nM ✅ |
38 nM ✅ |
8920 nM ❌ |
| VVVGADGVG |
9 |
52 nM ✅ |
380 nM ⚠️ |
245 nM ⚠️ |
5670 nM ❌ |
| KLVVVGADGV |
10 |
28 nM ✅✅ |
1890 nM ❌ |
2340 nM ❌ |
7800 nM ❌ |
| LVVVGADGVG |
10 |
67 nM ✅ |
290 nM ⚠️ |
89 nM ✅ |
4500 nM ❌ |
| VVVGADGVGK |
10 |
3200 nM ❌ |
62 nM ✅ |
55 nM ✅ |
6700 nM ❌ |
Legend: ✅✅ Strong binder (<50 nM) | ✅ Good binder (50-150 nM) | ⚠️ Moderate (150-500 nM) | ❌ Weak/Non-binder (>500 nM)
Key Insight: HLA-Matched Peptide Selection
A patient with HLA-A*02:01 and KRAS G12D should receive the KLVVVGADGV 10-mer (IC50 = 28 nM).
A patient with HLA-A*11:01 and KRAS G12D should receive the VVGADGVGK 9-mer (IC50 = 38 nM).
Same mutation. Different optimal peptides. This is why HLA matching is critical.
5. Pre-Designed mRNA Sequences
5.1 mRNA Architecture
5.2 Codon Optimization
Each peptide sequence is reverse-translated using optimized codons for human expression:
# Example: KRAS G12D epitope KLVVVGADGV
Wild-type AA: K L V V V G A D G V
Optimized: AAG CTG GTG GTG GTG GGC GCC GAC GGC GTG
Key optimizations:
- GC content: 55-65% (optimal for stability)
- Avoid rare codons (<10% usage)
- Eliminate mRNA secondary structures
- Remove cryptic splice sites
- Eliminate poly-U stretches (immunogenic)
- Substitute all U → N1-methylpseudouridine (Ψ)
5.3 mRNA Sequence Repository
{
"mrna_design": {
"design_id": "OPEN-NEO-KRAS-G12D-A0201-v1",
"target_mutation": "KRAS_G12D",
"target_hla": "HLA-A*02:01",
"peptide_sequence": "KLVVVGADGV",
"construct": {
"five_prime_cap": "CleanCap_AG",
"five_prime_utr": "GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC",
"signal_peptide": "MFVFLVLLPLVSSQCVNLT",
"epitope_with_flanks": "MTEYKLVVVKLVVVGADGVGKSALTI",
"linker": "AAY",
"three_prime_utr": "GCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAUGCCCUUCUUCUCUCCC...",
"poly_a_length": 120
},
"full_sequence_length": 847,
"gc_content": 0.58,
"predicted_half_life_hours": 18.5,
"modifications": {
"uridine": "N1-methylpseudouridine",
"cap": "Cap1"
},
"version": "1.0",
"validation_status": "computationally_validated",
"license": "CC-BY-SA-4.0",
"attribution_ip_id": "0x1234...Story_Protocol_IP_ID"
}
}
5.4 Multi-Epitope Constructs
For patients with multiple targetable shared mutations, multi-epitope mRNA constructs can be pre-designed:
Example: PDAC Multi-Target Vaccine
Patient profile: KRAS G12D + TP53 R175H + CDKN2A loss + SMAD4 R361H
HLA type: A*02:01, A*03:01, B*07:02
OpenNeoantigens construct:
- KRAS G12D epitopes for A*02:01 (KLVVVGADGV) and A*03:01 (VVGADGVGK)
- TP53 R175H epitopes for A*02:01 and A*03:01
- SMAD4 R361H epitopes if available
Construct ID: OPEN-NEO-PDAC-MULTI-A0201-A0301-v1
6. Clinical Validation Framework
6.1 Evidence Hierarchy
| Level |
Evidence Type |
Requirements |
Database Status |
| 1 |
Clinical response |
Documented T-cell response + clinical benefit in trial |
VALIDATED |
| 2 |
Immunogenic (human) |
T-cell response in human study, no clinical data yet |
VALIDATED |
| 3 |
Immunogenic (preclinical) |
T-cell response in mouse model with human HLA transgene |
EXPERIMENTAL |
| 4 |
Binding validated |
Experimental peptide-MHC binding assay |
EXPERIMENTAL |
| 5 |
Predicted only |
Computational prediction, no experimental validation |
COMPUTATIONAL |
6.2 Response Tracking Schema
{
"clinical_evidence": {
"evidence_id": "CE-2024-00142",
"peptide_id": "KRAS_G12D_10mer_pos5",
"hla_allele": "HLA-A*02:01",
"trial": {
"trial_id": "NCT04117087",
"phase": "1/2",
"sponsor": "Elicio Therapeutics",
"vaccine": "ELI-002"
},
"cohort": {
"n_patients": 25,
"cancer_types": ["PDAC", "CRC"],
"hla_matched": true
},
"outcomes": {
"t_cell_responders": 20,
"response_rate": 0.80,
"median_magnitude": "2.3-fold increase",
"duration_months": 12,
"clinical_benefit": {
"ctdna_clearance": 0.45,
"ca19_9_reduction": 0.84
}
},
"publication": {
"doi": "10.1038/s41591-024-XXXXX",
"pubmed_id": "38XXXXXX"
},
"data_contributed_by": "0xABC...contributor_wallet",
"contribution_timestamp": "2024-06-15T14:30:00Z"
}
}
6.3 Community Validation Process
7. Blockchain Attribution Layer
7.1 Story Protocol Integration
Every contribution to OpenNeoantigens is registered as an IP Asset on Story Protocol, ensuring permanent attribution:
What Gets Attributed
- Sequence submissions: First contributor of a validated peptide-HLA binding pair
- Clinical data: Researchers who contribute response data from trials
- mRNA designs: Contributors of optimized mRNA constructs
- Validation work: Labs that perform experimental binding assays
- Curation: Reviewers who validate submissions
7.2 IP Asset Structure
{
"ip_asset": {
"ip_id": "0x7890...OpenNeoantigens_KRAS_G12D",
"ip_type": "OPEN_NEOANTIGEN",
"metadata": {
"name": "KRAS G12D Neoantigen Dataset",
"description": "Complete HLA binding matrix and mRNA designs for KRAS G12D",
"mutation": "KRAS_G12D",
"content_hash": "QmXyz...IPFS_hash",
"version": "2.3.0"
},
"contributors": [
{
"address": "0xAAA...",
"role": "original_submitter",
"contribution": "Initial peptide predictions",
"share": 40
},
{
"address": "0xBBB...",
"role": "experimental_validator",
"contribution": "Binding assay data",
"share": 30
},
{
"address": "0xCCC...",
"role": "clinical_contributor",
"contribution": "Phase 1 response data",
"share": 30
}
],
"license": {
"type": "PIL_PUBLIC_GOOD",
"terms": {
"commercial_use": true,
"attribution_required": true,
"derivatives_allowed": true,
"share_alike": true
}
}
}
}
7.3 License Framework
| License Type |
Commercial Use |
Attribution |
Derivatives |
Use Case |
| PIL #4: Public Good |
✅ Free |
✅ Required |
✅ Share-alike |
Core database entries |
| PIL #1: Non-Commercial |
❌ No |
✅ Required |
✅ Allowed |
Research-only datasets |
| PIL #2: Commercial |
✅ Royalty |
✅ Required |
✅ Negotiable |
Pharma-contributed data |
7.4 Attribution NFT
Contributors receive a non-transferable Attribution NFT recording their contribution:
// OpenNeoantigens Attribution NFT (Soulbound)
contract OpenNeoantigenAttribution is ERC721, Soulbound {
struct Contribution {
string mutationId;
string contributionType; // "sequence", "binding_data", "clinical", "curation"
uint256 timestamp;
string ipfsMetadataHash;
uint256 citationCount;
}
mapping(uint256 => Contribution) public contributions;
mapping(address => uint256[]) public contributorTokens;
function mint(
address contributor,
string memory mutationId,
string memory contributionType,
string memory metadataHash
) external onlyValidator returns (uint256) {
// Mint soulbound attribution NFT
// Cannot be transferred, but proves permanent credit
}
function incrementCitation(uint256 tokenId) external {
// Called when someone uses/cites this contribution
contributions[tokenId].citationCount++;
}
}
8. API Specification
8.1 REST API Endpoints
BASE URL: https://api.openneoantigens.org/v1
# Query neoantigens by mutation
GET /mutations/{mutation_id}
GET /mutations?gene=KRAS&change=G12D
# Get HLA binding predictions
GET /bindings?mutation=KRAS_G12D&hla=HLA-A*02:01
GET /bindings/matrix?mutation=KRAS_G12D
# Get pre-designed mRNA sequences
GET /mrna?mutation=KRAS_G12D&hla=HLA-A*02:01
GET /mrna/{design_id}
# Query by patient HLA profile
POST /match
{
"mutations": ["KRAS_G12D", "TP53_R175H"],
"hla_class_i": ["HLA-A*02:01", "HLA-A*03:01", "HLA-B*07:02"],
"hla_class_ii": ["HLA-DRB1*01:01"]
}
# Get clinical evidence
GET /evidence?mutation=KRAS_G12D&hla=HLA-A*02:01
GET /evidence?trial_id=NCT04117087
# Submit new data (authenticated)
POST /contributions/binding
POST /contributions/clinical
POST /contributions/mrna
8.2 GraphQL Schema
type Query {
mutation(id: ID!): Mutation
mutations(gene: String, cancerType: String): [Mutation!]!
peptide(id: ID!): Peptide
peptides(mutationId: ID!, minLength: Int, maxLength: Int): [Peptide!]!
binding(peptideId: ID!, hlaAllele: String!): HLABinding
bindingMatrix(mutationId: ID!): BindingMatrix!
matchPatient(input: PatientMatchInput!): PatientMatchResult!
mrnaDesign(id: ID!): MRNADesign
mrnaDesigns(mutationId: ID!, hlaAllele: String): [MRNADesign!]!
clinicalEvidence(mutationId: ID, trialId: String): [ClinicalEvidence!]!
}
type Mutation {
id: ID!
gene: String!
proteinChange: String!
dnaChange: String!
cosmicId: String
somaticFrequency: [CancerFrequency!]!
peptides: [Peptide!]!
clinicalEvidence: [ClinicalEvidence!]!
}
type Peptide {
id: ID!
sequence: String!
length: Int!
mutantPosition: Int!
bindings: [HLABinding!]!
mrnaDesigns: [MRNADesign!]!
}
type HLABinding {
id: ID!
hlaAllele: String!
ic50Nm: Float!
percentileRank: Float!
bindingLevel: BindingLevel!
predictionTools: [PredictionResult!]!
experimentalValidation: ExperimentalValidation
}
type MRNADesign {
id: ID!
fullSequence: String!
gcContent: Float!
predictedHalfLife: Float!
license: String!
attributionIpId: String!
}
input PatientMatchInput {
mutations: [String!]!
hlaClassI: [String!]!
hlaClassII: [String!]
cancerType: String
}
type PatientMatchResult {
recommendedPeptides: [PeptideRecommendation!]!
mrnaConstructs: [MRNADesign!]!
clinicalEvidence: [ClinicalEvidence!]!
coverageScore: Float!
}
8.3 SDK Examples
# Python SDK Example
from openneoantigens import OpenNeoClient
client = OpenNeoClient(api_key="your_api_key")
# Find optimal epitopes for a patient
result = client.match_patient(
mutations=["KRAS_G12D", "TP53_R175H"],
hla_class_i=["HLA-A*02:01", "HLA-A*11:01"],
hla_class_ii=["HLA-DRB1*04:01"]
)
for peptide in result.recommended_peptides:
print(f"{peptide.sequence} | {peptide.hla} | IC50: {peptide.ic50_nm}nM | Evidence: {peptide.evidence_level}")
# Output:
# KLVVVGADGV | HLA-A*02:01 | IC50: 28nM | Evidence: CLINICAL_RESPONSE
# VVGADGVGK | HLA-A*11:01 | IC50: 38nM | Evidence: IMMUNOGENIC_HUMAN
# HMTEVVRHC | HLA-A*02:01 | IC50: 156nM | Evidence: BINDING_VALIDATED
# Get ready-to-manufacture mRNA sequence
mrna = client.get_mrna_design(
mutation="KRAS_G12D",
hla="HLA-A*02:01"
)
print(f"mRNA construct: {mrna.design_id}")
print(f"Sequence length: {mrna.sequence_length} nt")
print(f"License: {mrna.license}") # CC-BY-SA-4.0
9. Governance Model
9.1 OpenNeoantigens DAO
9.2 Governance Token
ONEO Token Distribution
- 40% - Contributors: Earned through validated data contributions
- 25% - Foundation: Long-term development and maintenance
- 20% - Scientific Advisors: Vested over 4 years
- 10% - Early Supporters: Initial funding contributors
- 5% - Ecosystem Grants: Tool developers, integrators
Earning ONEO: 1 token per validated peptide-HLA submission, 10 tokens per clinical evidence contribution, 5 tokens per mRNA design, 0.5 tokens per curation review.
9.3 Scientific Advisory Board
The SAB provides scientific oversight and consists of:
- 3 Academic oncologists/immunologists
- 2 Computational biologists
- 1 Regulatory expert
- 1 Patient advocate
SAB members serve 3-year terms, renewable once. They review evidence standards, resolve disputes, and guide research priorities.
10. Integration with BioNFT Ecosystem
10.1 Hybrid Vaccine Strategy
OpenNeoantigens complements—not replaces—the patient-owned BioNFT system:
10.2 API Integration
# GenoBank BioNFT API integration with OpenNeoantigens
# Patient's BioNFT contains their private neoantigens
patient_bionft = genobank.get_bionft(biosample_id="99990000000001")
# Query OpenNeoantigens for their shared mutations
shared_targets = openneo.match_patient(
mutations=patient_bionft.shared_mutations, # ["KRAS_G12D", "TP53_R175H"]
hla=patient_bionft.hla_type
)
# Combine with patient's private neoantigens
private_targets = patient_bionft.private_neoantigens # Patient-owned, consent-gated
# Generate combined vaccine design
vaccine_design = genobank.design_vaccine(
shared_epitopes=shared_targets.peptides, # From OpenNeoantigens (free)
private_epitopes=private_targets.peptides, # From BioNFT (patient-owned)
patient_hla=patient_bionft.hla_type
)
# Attribution tracking
vaccine_design.attribution = {
"shared_components": shared_targets.attribution_ip_ids, # Story Protocol IPs
"private_components": patient_bionft.ip_id, # Patient's BioNFT IP
"design_contributor": "GenoBank.io"
}
10.3 Economic Model
| Component |
Source |
Cost to Patient |
Attribution |
| Shared neoantigen sequences |
OpenNeoantigens |
Free |
CC-BY-SA (cite database) |
| Pre-designed mRNA (shared) |
OpenNeoantigens |
Free |
Story Protocol IP credit |
| Private neoantigen sequences |
Patient BioNFT |
Patient-owned |
Patient retains 100% IP |
| Custom mRNA design |
GenoBank/CDMO |
Service fee |
Design IP to patient |
| GMP Manufacturing |
CDMO Partner |
Manufacturing cost |
Process IP to CDMO |
| Clinical administration |
Physician |
Medical fee |
N/A |
11. Implementation Roadmap
Phase 1: Foundation (Q1-Q2 2026)
- ✅ Database schema design and implementation
- ✅ Initial mutation set curation (50 hotspots)
- ⬜ HLA binding predictions for top 30 alleles
- ⬜ Story Protocol IP registration framework
- ⬜ REST API v1.0 launch
- ⬜ Documentation and SDK release
Phase 2: Expansion (Q3-Q4 2026)
- ⬜ Expand to 200+ mutations
- ⬜ Add fusion protein neoantigens
- ⬜ Add viral oncoprotein database
- ⬜ GraphQL API launch
- ⬜ Clinical evidence integration from published trials
- ⬜ mRNA design repository with 1000+ constructs
Phase 3: Validation (2027)
- ⬜ Partner with 3+ academic medical centers for validation studies
- ⬜ Experimental binding validation for top 500 peptide-HLA pairs
- ⬜ Integration with CDMO manufacturing partners
- ⬜ DAO governance launch
- ⬜ First patient treatments using OpenNeoantigens-derived vaccines
Phase 4: Scale (2028+)
- ⬜ 1000+ validated neoantigens
- ⬜ Pan-cancer coverage
- ⬜ Real-world response data integration
- ⬜ AI-driven epitope optimization
- ⬜ Global CDMO network for manufacturing
12. Appendix: Initial Mutation Set
12.1 Priority 1: High-Frequency Drivers (Launch Set)
| # |
Gene |
Mutation |
Cancer Types |
Frequency |
Existing Vaccine Data |
| 1 |
KRAS |
G12D |
PDAC, CRC, NSCLC |
13-41% |
ELI-002, autogene cevumeran |
| 2 |
KRAS |
G12V |
PDAC, CRC, NSCLC |
8-30% |
ELI-002 |
| 3 |
KRAS |
G12C |
NSCLC, CRC |
3-13% |
Multiple programs |
| 4 |
KRAS |
G12R |
PDAC |
16% |
ELI-002 |
| 5 |
KRAS |
G13D |
CRC |
7% |
Limited |
| 6 |
BRAF |
V600E |
Melanoma, CRC, Thyroid |
40-60% |
Multiple trials |
| 7 |
TP53 |
R175H |
Pan-cancer |
6% |
Limited |
| 8 |
TP53 |
R248Q |
Pan-cancer |
4% |
Limited |
| 9 |
TP53 |
R273H |
Pan-cancer |
4% |
Limited |
| 10 |
PIK3CA |
H1047R |
Breast, Endometrial |
15-30% |
Limited |
| 11 |
PIK3CA |
E545K |
Breast, Endometrial |
10-15% |
Limited |
| 12 |
IDH1 |
R132H |
Glioma, AML |
70-90% |
Peptide vaccine trials |
| 13 |
NRAS |
Q61R |
Melanoma |
15% |
Limited |
| 14 |
NRAS |
Q61K |
Melanoma, AML |
10% |
Limited |
| 15 |
EGFR |
L858R |
NSCLC |
10-15% |
Limited |
12.2 Priority 2: Fusion Proteins
| Fusion |
Cancer Type |
Frequency |
Junction Peptides |
| BCR-ABL (p210) |
CML |
95% |
ATGFKQSSKALQRPVAS |
| BCR-ABL (p190) |
ALL |
25% |
HSATGFKQSSKALQRPVAS |
| EML4-ALK V1 |
NSCLC |
2% |
To be characterized |
| EML4-ALK V3 |
NSCLC |
2% |
To be characterized |
| TMPRSS2-ERG |
Prostate |
50% |
To be characterized |
12.3 Priority 3: Viral Oncoproteins
| Virus |
Protein |
Cancer Type |
Known Epitopes |
| HPV16 |
E6 |
Cervical, Oropharyngeal |
Multiple HLA-restricted epitopes characterized |
| HPV16 |
E7 |
Cervical, Oropharyngeal |
YMLDLQPETT (HLA-A*02:01) |
| HPV18 |
E6, E7 |
Cervical |
Multiple characterized |
| EBV |
LMP1, LMP2 |
Nasopharyngeal, Hodgkin |
Extensive database available |
Summary
OpenNeoantigens represents a new paradigm in cancer vaccine development: a public commons for shared cancer targets that accelerates access while preserving attribution through blockchain technology. By open-sourcing the ~30% of neoantigens derived from common driver mutations, we can:
- Eliminate weeks of delay for patients with targetable hotspot mutations
- Pool clinical validation data across thousands of patients
- Enable global access to validated vaccine designs
- Complement patient-owned private neoantigens through the BioNFT system
The protocol launches with 15 high-priority mutations covering the most common oncogenic drivers, with plans to expand to 200+ mutations and comprehensive fusion/viral databases by 2027.
OpenNeoantigens + BioNFTs = Complete patient sovereignty over cancer immunotherapy.